Review



smartseq2 v4 kit takara clontech  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    TaKaRa smartseq2 v4 kit takara clontech
    Highlights:
    Smartseq2 V4 Kit Takara Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 3231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/pmc07255058-845-99-102
    Average 98 stars, based on 3231 article reviews
    smartseq2 v4 kit takara clontech - by Bioz Stars, 2026-09
    98/100 stars

    Images

    1) Product Images from "Reprogramming axial level identity to rescue neural crest-related congenital heart defects"

    Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

    Journal: Developmental cell

    doi: 10.1016/j.devcel.2020.04.005

    Highlights:
    Figure Legend Snippet: Highlights:

    Techniques Used: Isolation, Hybridization, Software

    Related Articles

    Lysis:

    Article Title: Mitogenic and progenitor gene programmes in single pilocytic astrocytoma cells
    Article Snippet: .. Cells were collected in 5 μl of 1 × Lysis buffer (SmartSeq2 v4 kit, Takara) containing 1% b-mercaptoethanol, spun at 800 × g , snap frozen on dry ice, and stored at −80 °C prior to library preparation. .. cDNA libraries for BT618, BT646, and BT679 were prepared using the a modified SmartSeq protocol . cDNA libraries for BT801, BT827, BT906 we prepared using SmartSeq v4 kit (Takara) with the following modifications.

    Isolation:

    Article Title: From Pioneer to Repressor: Bimodal foxd3 Activity Dynamically Remodels Neural Crest Regulatory Landscape In Vivo
    Article Snippet: .. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit (AM1931), checked on Bioanalyser, samples with RIN>7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit (634889). .. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit (FC-131-1024).

    Article Title: From pioneer to repressor: Bimodal foxd3 activity dynamically remodels neural crest regulatory landscape in vivo
    Article Snippet: .. RNA was extracted using Ambion RNAqueous Micro Total RNA isolation kit (AM1931), checked on Bioanalyser, samples with RIN > 7 were used to prepare cDNA using Takara Clontech SmartSeq2 V4 kit (634889). .. Sequencing libraries were prepared using Illumina Nextera XT library preparation kit (FC-131-1024).



    Similar Products

    98
    TaKaRa smartseq2 v4 kit takara clontech
    Highlights:
    Smartseq2 V4 Kit Takara Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/pmc07255058-845-99-102
    Average 98 stars, based on 1 article reviews
    smartseq2 v4 kit takara clontech - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    TaKaRa smartseq2 v4 kit
    Highlights:
    Smartseq2 V4 Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/pmc07255058-12-0-4
    Average 98 stars, based on 1 article reviews
    smartseq2 v4 kit - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    TaKaRa 212 smartseq2 v4 kit takara clontech
    Highlights:
    212 Smartseq2 V4 Kit Takara Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/gandhi_shashank__2021__molecular_mechanisms_underlying_cardiac_neural_crest_development_in_avian_embryos-3759-0-4
    Average 98 stars, based on 1 article reviews
    212 smartseq2 v4 kit takara clontech - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    TaKaRa smartseq2 kit
    Highlights:
    Smartseq2 Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+PLUS+Kit/pm32242021-386-12-14
    Average 98 stars, based on 1 article reviews
    smartseq2 kit - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results


    Highlights:

    Journal: Developmental cell

    Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

    doi: 10.1016/j.devcel.2020.04.005

    Figure Lengend Snippet: Highlights:

    Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse IgG1 anti-Pax7 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_528428 Rabbit anti-Sox2 Abcam Cat#ab97959; RRID: AB_2341193 Mouse IgG2b anti-MF20 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2147781 Mouse IgM anti-HNK1 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2314644 Mouse IgG2a anti-SMA Sigma Cat#3879S; RRID: AB_2255011 Mouse IgG2b anti-HuC/D Invitrogen Cat# A21271; RRID: AB_221448 Goat IgG anti-GFP Rockland Cat# 600-101-215; RRID: AB_218182 Mouse IgG2a anti-V5 Invitrogen Cat#R960–25; RRID: AB_2556564 Rabbit anti-RFP MBL Cat#PM005; RRID: AB_591279 Critical Commercial Assays RNAqueous Micro Total RNA isolation kit Ambion Cat#AM1931 SmartSeq2 V4 kit Takara Clontech Cat#634889 Nextera XT DNA library preparation kit Illumina Cat#FC-131–1024 Qubit High sensitivity DNA kit ThermoFisher Scientific Cat# {"type":"entrez-protein","attrs":{"text":"Q32854","term_id":"75280861","term_text":"Q32854"}} Q32854 NEB Next High-Fidelity 2X PCR Master Mix New England Biolabs Cat#M0543S NextSeq 500/550 High Output Kit v2 (75 cycles) Illumina Cat#FC-404–2005 Endofree maxi prep kit Macharey Nagel Cat#740426.50 Agencourt AMPure XP beads Beckman Coulter Cat#A63880 illustra MicroSpin G-50 Columns GE Healthcare Life Sciences Cat# 27533001 Hybridization Chain Reaction Molecular Technologies NA Deposited Data Raw and analyzed data This paper BioProject ID PRJNA515142 Software and Algorithms Fiji/ImageJ ( Schindelin et al., 2012 ) https://imagej.nih.gov/ij/ Bowtie2 ( Langmead and Salzberg, 2012 ) http://bowtie-bio.sourceforge.net/bowtie2/index.shtml Samtools http://samtools.sourceforge.net/ HTSeq-count https://htseq.readthedocs.io/en/release_0.11.1/count.html Seurat ( Butler et al., 2018 ) https://satijalab.org/seurat/ Oligonucleotides GCAGGTGTAGTTGCAATATC This paper Tgif1.1.gRNA GTTGGTCCCCCGCCGTGAGA This paper Tgif1.2.gRNA GGGTCATGTTGAGCATTTGG This paper Sox8.1.gRNA gTCCACCTTAGCGCCCAGCG This paper Sox8.2.gRNA GACGCGACGCCCATCCTCAA This paper Sox8.3.gRNA GGCCTCAACCATGAAGGCGG This paper Ets1.1.gRNA GACCTTCAGTGGCTTCGCAA This paper Ets1.2.gRNA GAGAGACGCACGTGCGGGAC This paper Ets1.3.gRNA GAAAGTCAGGCGCTAGCTCC This paper Ets1.4.gRNA Open in a separate window Highlights: Ablations reveal laterality differences in neural crest contributions to the heart Transcriptional profiling reveals Tgif1 as critical for outflow tract morphogenesis Sox8, Tgif1 , and Ets1 comprise a regulatory subcircuit for cardiac crest specification Expression of subcircuit genes in trunk reprograms them toward cardiac crest-like fate

    Techniques: Isolation, Hybridization, Software

    Highlights:

    Journal: Developmental cell

    Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

    doi: 10.1016/j.devcel.2020.04.005

    Figure Lengend Snippet: Highlights:

    Article Snippet: SmartSeq2 V4 kit , Takara Clontech , Cat#634889.

    Techniques: Isolation, Hybridization, Software